Procedure

This procedure will create a restriction map of a DNA sequence and send the result to the Output window.

1. Proceed to the selection of restriction enzymes in the Restriction Enzyme Window if necessary.

If the Restriction Enzyme Window is not open, the set of prototypes (all enzymes without isoschizomers) will be used.

2. Choose Analysis > Restriction Analysis > Restriction Map in the main menu or Sequence Analysis > Restriction Analysis > Restriction Map in the selection contextual menu.

A sequence must be selected prior to operate a restriction analysis, e.g. click Ctrl-A to selected all the nucleotides in the sequence viewer first.

3. Alternatively click on the Restriction Map button () in the Restriction Enzyme Window operation toolbar. If the button is not active, reselect the sequence or activate the window containing the sequence, like for example a sequence node in the Explorer Window, before clicking in the toolbar.

4. Open the Output multitab window to access the result.

Example of output

The following map was generated by mapping all prototypes on M20573:

      M20573  •  Restriction Map
      DNA oligo   57 bp   tgccaacaatggggtcgtaaccccacgttcggaggggggaccaagctggaaataaaa
      
                                                 SinI                    
                                    HpyCH4IV     PspPI AluI                           
                                 BseLI  Hpy188I BslFI  CviJI                               
              BseLI         MaeIII  SetI   MnlI BspLI  SetI                                      
              |             |    |  |   |  |    ||     |             
          1 tgccaacaatggggtcgtaaccccacgttcggaggggggaccaagctggaaataaaa 57   
                     •         •         •         •         •